Prova comentada – Unicamp 2017 – primeira fase

Unicamp 2017: resolução da prova de biologia

01) Pesquisadores analisaram o número de polinizadores, a biodiversidade e o rendimento de cultivos dependentes de polinizadores (maçã, pepino, caju, café, feijão, algodão e canola, entre outros) em propriedades da África, Ásia e América do Sul. Nos países analisados, o rendimento agrícola cresceu de acordo com a densidade de polinizadores, indicando que a redução na população de abelhas e outros insetos poderia ser parcialmente responsável pela queda de produtividade.
(Adaptado de http://revistapesquisa.fapesp.br/2016/01/21 /insetoselevam-produtividade-agricola/)
Os resultados obtidos com a pesquisa relatada acima sugerem que:
A) A presença de insetos nas lavouras pode ser uma das causas da queda de produtividade e biodiversidade.
B) Práticas agrícolas convencionais, com uso de pesticidas, favorecem os polinizadores e aumentam a produtividade.
C) A adoção de medidas que ofereçam condições de vida mais favoráveis a polinizadores pode resultar em aumento de produtividade do feijão.
D) A biodiversidade observada na África, Ásia e América do Sul demanda uso intenso de defensivos agrícolas.

02) Considerando o esquema a seguir como uma representação simplificada da meiose, indique a alternativa correta.

A) A, B, D e F são diploides.
B) B, C, D e E são formados na telófase I.
C) A, B, D e G são células idênticas quanto ao seu material genético.
D) B, C, D e I são haploides.

03)  O gráfico a seguir representa a variação do índice glicêmico após a ingestão de dois alimentos (mesma quantidade, pela mesma pessoa, mas em momentos diferentes). A linha pontilhada representa o alimento A, enquanto a linha contínua representa o alimento B. A análise do gráfico nos permite afirmar corretamente que:

A) O alimento B não afeta a concentração de glicose na circulação sanguínea.
B) O alimento A não possui carboidratos em sua composição.
C) O alimento B ajuda a emagrecer, pois estimula a liberação de adrenalina.
D) O alimento A estimula a liberação de insulina na circulação sanguínea.

04)  O HPV faz parte do grupo dos caudovírus. As verrugas genitais causadas pela infecção do vírus foram estudadas desde a Antiguidade, porém o vírus só foi descoberto 40 anos atrás.
Pode-se afirmar corretamente que:
A) A principal forma de se adquirir o HPV é através da ingestão de alimentos contaminados.
B) O câncer de colo de útero não pode ser causado pelo vírus HPV.
C) O vírus HPV pode permanecer latente por vários anos.
D) Não há tratamento nem vacina para o HPV.

05) O cladograma abaixo representa relações evolutivas entre membros da Superfamília Hominoidea, onde se observa que

A) homens e gibões (Hylobatidae) não possuem ancestral comum.
B) homens, gorilas (Gorilla) e orangotangos (Pongo) pertencem a famílias diferentes.
C) homens, gibões e chimpanzés (Pan) possuem um ancestral comum.
D) homens, orangotangos (Pongo) e gibões (Hylobatidae) são primatas pertencentes à mesma família.

06) Na vida real não existem animais que são agentes secretos, mas o ornitorrinco, representado na figura do desenho Phineas e Ferb, guarda muitos segredos e curiosidades. Esse animal de aproximadamente 60 cm, que parece uma mistura de lontra, pato e castor, resultou em um ser único em vários sentidos.

A) À semelhança dos mamíferos placentários, a fêmea do ornitorinco alimenta os filhotes com seu leite, mas coloca ovos.
B) Diferentemente dos mamíferos placentários, os ornitorrincos não produzem leite para a alimentação dos filhotes.
C) À semelhança dos mamíferos placentários, os embriões dos ornitorrincos alimentam-se exclusivamente de vitelo acumulado no ovo.
D) Diferentemente dos mamíferos placentários, os ornitorrincos apresentam autofecundação e produzem ovos.

07)  A figura a seguir ilustra fragmentos de um gene presente em 4 espécies identificadas com os números de 1 a 4 entre parênteses.

CACTTGTAAAACCAGTATAGACCCTAG (1)
CACTTGTAAAACCAGGATAGACGCTAG(2)
CACTTGTAAAACCAGTATAGACGCTAG (3)
CATTTTTAACACCAGGATAGACGCTAT(4)

Assinale a alternativa correta.
A) As espécies 1 e 4 são mais próximas entre si do que as espécies 1 e 3.
B) As espécies 2 e 3 são mais próximas entre si do que as espécies 1 e 3.
C) As espécies 1 e 3 são mais próximas entre si do que as espécies 3 e 4.
D) As espécies 2 e 4 são mais próximas entre si do que as espécies 1 e 2.

08) O corpo humano é composto por pelo menos dois tipos de gordura. A mais comum é o tecido adiposo branco, um tipo perigoso que se acumula ao redor das vísceras e debaixo da pele, podendo causar obesidade e desencadear complicações metabólicas, como o diabetes tipo 2. A outra é o tecido adiposo marrom, que regula a produção de calor e, consequentemente, a temperatura corporal.
Assinale a alternativa correta.
A) O tecido adiposo branco produz mais energia que o tecido adiposo marrom.
B) O tecido adiposo marrom não produz ATP, mas produz calor.
C) O tecido adiposo branco não produz ATP, mas produz calor.
D) O tecido adiposo branco produz ATP e calor.

09) Ao observar uma célula, um pesquisador visualizou uma estrutura delimitada por uma dupla camada de membrana fosfolipídica, contendo um sistema complexo de endomembranas repleto de proteínas integrais e periféricas. Verificou também que, além de conter seu próprio material genético, essa estrutura ocorria em abundância em todas as regiões meristemáticas de plantas. Qual seria essa estrutura celular?
A) Cloroplasto.
B) Mitocôndria.
C) Núcleo.
D) Retículo endoplasmático.

Resolução:
01) No enunciado há a informação de que a redução na população de abelhas e de outros insetos polinizadores poderia ser parcialmente responsável pela queda de produtividade das plantas citadas, dentre elas, o feijão. Dessa forma, a adoção de medidas que favoreçam condições de vida mais favoráveis a polinizadores poderá aumentar a produtividade.
Resp.: C

02) Em A ocorreu meiose I, que se caracteriza pela segregação dos homólogos. Dessa forma, as células indicadas por B e C são haploides, porém, com cromossomos duplos.
Em D e em E ocorreu meiose II, com a consequente separação das cromátides irmãs. Assim, as células indicadas por F, G, H e I são haploides, porém, com cromossomos simples.
Resp.: D

03) Após a ingestão do alimento indicado por A ocorre um súbito aumento da glicemia (taxa de glicose na corrente sanguínea). Esse fator estimula o pâncreas a liberar insulina, para baixar o índice glicêmico.
Resp.: D

04) O papilomavírus humano (HPV) é adquirido principalmente por relações sexuais. Esse vírus possui um período de latência muito variável; as verrugas podem surgir após um período de latência de 3 a 6 meses, porém, há relatos de período de latência de até décadas.
Resp.: C

05) Analisando o cladograma, conclui-se que todos os gêneros descendem de um ancestral comum, uma vez que todos pertencem à mesma superfamília. Os gibões (gênero Hylobates) pertencem a uma família diferentes dos demais organismos sendo, portanto, o com menor grau de parentesco entre eles.
Resp.: C

06) O ornitorrinco é um anima ovíparo, porém, os filhotes se alimentam de leite. Como esses animais não possuem glândulas mamárias, o leite escorre até uma região do peito da fêmea e os filhotes lambem-no.
Resp.: A

07) Analisando-se a sequencia de bases nitrogenadas do fragmento do gene citado, observa-se uma maior semelhança entre a sequência do indivíduo da espécie 1 e da espécie 3; logo, são espécies mais aparentadas.
Resp.: C

08) O tecido adiposo marrom é constituído por células em cujo interior há várias gotas de gordura. As células desse tecido possuem muitas mitocôndrias que utilizam de um complexo proteico de baixa eficiência na produção de ATP.    A função primária desse tecido é a termogênese (geração de calor para a manutenção da temperatura corporal), o que é conseguido graças à presença da termogenina, uma proteína presente na membrana interna da mitocôndria.
Já o tecido adiposo branco possui células em cujo interior há uma única gota de gordura (chega a ocupar até 85% do conteúdo citoplasmático) cuja quebra libera energia (ATP) para o funcionamento celular (e com a quebra do ATP ocorre liberação de calor).
Resp.: D

09) O tecido meristemático possui elevada taxa mitótica, o que exige grande quantidade de energia, que é obtida pelas atividade das mitocôndrias.
Resp.: B

Veja também:
Prova comentada da Puc-Campinas 2017-2

Deixe um comentário

O seu endereço de e-mail não será publicado. Campos obrigatórios são marcados com *